Review



malachite green phosphate detection kit r d systems cat  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    R&D Systems malachite green phosphate detection kit r d systems cat
    Malachite Green Phosphate Detection Kit R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 109 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/malachite+green+phosphate+detection+kit+r+d+systems+cat/Malachite+Green+Phosphate+Detection+Kit/pm41861786-247-86-91
    Average 95 stars, based on 109 article reviews
    malachite green phosphate detection kit r d systems cat - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Positive Control:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Agarose Gel Electrophoresis:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Extraction:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Sample Prep:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Multiplex sample analysis:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Mass Spectrometry:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Ubiquitin Proteomics:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    CRISPR:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Real-time Polymerase Chain Reaction:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Cloning:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Mutagenesis:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Control:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Recombinant:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Plasmid Preparation:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Bradford Protein Assay:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Blocking Assay:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    cDNA Synthesis:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Glo Assay:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026

    Multiple Displacement Amplification:

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 12 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Chemical compound, drug Rotenone Sigma- Aldrich Cat#R8875, CAS: 83- 79- 4 Chemical compound, drug Antimycin A from Streptomyces sp. Sigma- Aldrich Cat#A8674, CAS: 1397- 94- 0 Chemical compound, drug CelLytic M buffer Sigma- Aldrich Cat#C2978 Chemical compound, drug Halt protease and phosphatase cocktail inhibitors Sigma- Aldrich Cat#78440 Chemical compound, drug Bradford protein assay dye reagent Bio- Rad Cat#500–0006 Chemical compound, drug Protein Block DAKO solution Agilent Cat#X0909 Chemical compound, drug Fluoromount Aqueous Mounting Medium Sigma- Aldrich Cat#F4680 Chemical compound, drug Formalin solution, neutral buffered, 10% Sigma- Aldrich Cat#HT5011 Chemical compound, drug Triton X- 100 reduced Sigma- Aldrich Cat#X100RS; CAS: 92046- 34- 9 Chemical compound, drug 7- amino- actinomycin D (7- AAD) eBioscience Cat#00- 6993- 50 Peptide, recombinant protein Recombinant human adenosine deaminase (rhADA) R&D systems Cat#7048- AD, Acc#P00813 Peptide, recombinant protein Recombinant human CD73 (rhCD73) R&D systems Cat#5795- EN, Acc#AAH659937 Commercial assay, kit Malachite green phosphate detection kit R&D systems Cat#DY996 Commercial assay, kit SuperScript VILO cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 Commercial assay, kit RNeasy mini kit QIAGEN Cat#74104 Commercial assay, kit ALDEFLUOR kit Stemcell Cat#01700 Commercial assay, kit Amersham ECL prime detection reagent GE healthcare lifescience Cat#RPN2232 Commercial assay, kit Glutamine/Glutamate- Glo Assay kit Promega Cat#J8021 Cell line (homosapiens) MDA- MB- 231 (TNBC) ATCC HTB- 26 Cell line (homosapiens) PANC- 1 (pancreatic cancer) ATCC CRL- 1469 Cell line (homosapiens) SK23MEL (metastatic melanoma) MSK Cancer Center RRID: CVCL_6027 Cell line (homosapiens) HCC1954 (breast cancer) ATCC CRL- 2338 Cell line (homosapiens) OV1369 (ovarian cancer) Dr. Anne- Marie MesMasson Fleury et al., 2019 Cell line (homosapiens) SKOV3 (ovarian cancer) ATCC HTB- 77 Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: The CD73 immune checkpoint promotes tumor cell metabolic fitness.
    Article Snippet: DOI: https://doi.org/10.7554/eLife.84508 13 of 22 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (homosapiens) HEK293FT (human embryonic kidney) Dr. Francis Rodier RRID: CVCL_6911 Cell line (homosapiens) UWB1.289+BRCA1 Dr. Madhuri Koti RRID: CVCL_B078 Cell line (Mus musculus) 4T1.2 (mammary cancer) ATCC CRL- 2539 Cell line (Mus musculus) SM1 LWT1 (metastatic melanoma) Dr. Mark Smyth Cell line (Mus musculus) MEF from C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Cell line (Mus musculus) MEF from Nt5e-/- C57BL/6 J This paper Generated in Dr. Stagg’s laboratory Strain, strain background (mouse) NOD.Cg- Rag1tm1Mom Il2rgtm1Wjl/SzJ (NRG) Jackson Laboratory JAX: 007799 Strain, strain background (mouse) C57BL/6 J Jackson Laboratory JAX: 000664 Strain, strain background (mouse) B6.129S1- Nt5etm1Lft/J (CD73-/- C57BL/6 J) Dr. Linda Thompson JAX: 018986 Sequence- based reagent Nt5e Thermo Fisher Scientific Cat#4331182, Mm00501910_m1 Sequence- based reagent Actb Thermo Fisher Scientific Cat#4331182, Mm00607939_s1 Sequence- based reagent NMRK1 Thermo Fisher Scientific Cat#4331182, Hs00944470_m1 Sequence- based reagent ACTB Thermo Fisher Scientific Cat#4331182, Hs99999903_m1 Sequence- based reagent ADORA2A Thermo Fisher Scientific Cat#4331182, Hs00169123_m1 Sequence- based reagent ADORA2B Thermo Fisher Scientific Cat#4331182, Hs00386497_m1 Recombinant DNA reagent pLenti- PGK- ERKRAS G12V (plasmid) Dr. Francis Rodier Rodier et al., 2009; Addgene#35635 Recombinant DNA reagent pLHCX (plasmid) Dr. Lucas Sullivan Sullivan et al., 2018 Recombinant DNA reagent pLHCX- gpASNase1 Dr. Lucas Sullivan Sullivan et al., 2018; Addgene#121526 Recombinant DNA reagent shGFP Sigma- Aldrich TRCN0000075219 Recombinant DNA reagent shNRK1 Sigma- Aldrich TRCN0000160469 Other DMEM Wisent Cell culture reagent Other Glucose/glutamine/sodium pyruvate- free DMEM Wisent Cell culture reagent Other RPMI 1640 Wisent Cell culture reagent Other OSE Wisent Cell culture reagent Other Dialyzed FBS Wisent Cell culture reagent Other Seahorse base media Agilent Cell culture reagent Continued Continued on next page Allard et al. eLife 2023;12:e84508.

    Article Title: ZNFX1 uses two-component ubiquitin circuitry to quarantine viral RNA.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER UCHL3 (deubiquitinase) MRC Reagents and Services DU21015 Photocrosslinking E2∼Ub activitybased probe (UBE2D3 WT and F62A) Mathur et al.57 N/A Biotinylated UBE2D3∼Ub activitybased probe Pao et al.25 N/A Biotinylated UBE2L3∼Ub activitybased probe Pao et al.25 N/A RNF4 fused dimer (positive control) Rojas-Fernandez et al.84 N/A Critical commercial assays DNeasy Blood & Tissue Kit Qiagen N/A HiScribe® T7 High Yield RNA Synthesis Kit NEB Cat#E2040S Agarose gel extraction kit NEB Cat#T1020S Monarch DNA cleanup kit NEB Cat#T1030 Monarch RNA cleanup kit NEB Cat#T2030S Malachite Green Phosphate Detection Kit R&D Systems Cat#DY996 NativePAGETM Sample Prep Kit Invitrogen Cat#BN2008 Deposited data SILAC-ABPP mass spectrometry data PRIDE PXD065503 ZNFX1-ABP Crosslinking mass spectrometry data PRIDE PXD073419 Ubiquitination site mapping mass spectrometry PRIDE PXD073484 SINV viral RNA interactome Garcia-Moreno et al.35 PXD029492 Experimental models: Cell lines Human: T-RExTM-293-Flp-In Gift from Alfredo Castello RRID:CVCL_U427 African green monkey: VeroE6 Gift from Massimo Palmarini N/A Human: THP-1 Gift from Dario Alessi RRID:CVCL_0006 Hamster: BHK21 Gift from Alfredo Castello N/A Spodoptera frugiperda Sf9 insect cells Thermo Fisher Scientific Cat#11496015 Oligonucleotides CRISPR gRNA (ZNFX1 guide 1) TCCTAACCAACGAGTCTGTT N/A CRISPR gRNA (ZNFX1 guide 4) AGCGGTTCTGACAGGTCCGC N/A qPCR forward primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR reverse primer: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR probe: ACTB Hs01060665_g1 Thermo Fisher Scientific Cat#4331182 qPCR forward primer: SINV nsp1/2 CGCGGTCACGTAAGGATAAT N/A qPCR reverse primer: SINV nsp1/2 GTGCGAGTTTGGCATTCTTC N/A qPCR probe: SINV nsp1/2 TATCGTTGTCTCGCCAAACTCTGTGC N/A qPCR forward primer: Capsid TGAAAGGAACCATCGACCAC N/A qPCR reverse primer: Capsid GCCTCACTTCTCATGTTGACT N/A qPCR probe: Capsid AGCATACGACATGGAGTTCGCACA N/A Cloning and mutagenesis primers; See Table S1 This paper N/A Fluc Control Template NEB N0426AVIAL Recombinant DNA pSpCas9(BB)-2A-Puro (px459) Addgene (Feng Zhang lab) Addgene plasmid #48139; RRID:Addgene_48139 (Continued on next page) e3 Molecular Cell 86, 1164–1181.e1–e12, March 19, 2026



    Similar Products

    95
    R&D Systems malachite green phosphate detection kit r d systems cat
    Malachite Green Phosphate Detection Kit R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/malachite+green+phosphate+detection+kit+r+d+systems+cat/Malachite+Green+Phosphate+Detection+Kit/pm41861786-247-86-91
    Average 95 stars, based on 1 article reviews
    malachite green phosphate detection kit r d systems cat - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    Image Search Results